CBrugiaQ_2920


Sequence

>CBrugiaQ_2920 (5 EST) Length=531 ATAATGACGATATTTTTTGTTTAATCCCACTATTCCATAATATAACAATCTATATTCATTGTTTACTCATGAAATCCCTA TGCCTATTCAATCTACGTTTTCACGGGCGTGATTTTTTTTTATTTCATACATCGTTTTCTTGTATACCTAAAAGTGCGTG GTTTGTTCTGTAGTTCTTAAGTTCATGGTGTAATGTTCATTTTTTTCTTTAAACTTAGTGTTGTCCTAATGTAATTGTTG TAGTAGGAAGCCAAGTCATTGTTGTTGCTGTTTTTTAAAACTAATTTGAAATTTAATTTCAATTATGGATTTCTCTTATT TTTATCACCATTTGGGATAACTTGCAATTGGTTAATTTTTCTCATCTTTCCAAATTTTAAAGAATTGAGATTTCTAGTTA TGCAAGAATCAGTTTAGCTTTTTGTTTTAAACTGTATTTGTCAGTTTTCTAGACTTGGAATTTAAAATTTTGAGATTTAA ATTATGTTACTCTGTGCATCGTCTTTAAATAAATGAATGTCCACCGTTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2920: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217629808451R47564SWAMCA042SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304991300249W23395SWAMCA722SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8002271737610AA161684MBAFCF1F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9141371912507AA273133SW3ICA2112SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10482972064944AA406952MBAFCZ7C03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 17:11:28 on Wed 22 Nov 117.