CBrugiaQ_2930


Sequence

>CBrugiaQ_2930 (16 EST) Length=341 AGNATCGGATTCATTAGTTTATTTGCAACCGTTAAGTGTATCAATCTAATAGCAATACTTAAATGCGAAGTGTTGTCAAG TTATCGCGTAAACATATAATCCATTTTTCAAAGCTTCTGAGAAATTCGTTGGGCGGGAATCCCTTCACAGGAGGCAAATC ACAAAAAATCCCATTCGTCGCTAACAGTTCGTACGAGAAAAATGCCACCAATAAAAACCACCAGACTCTTACACATATTC CAGTAGAATGGATTGTGATAAATCCACGAAAGAGATCCTCCATGTGGAGATGGCGCTGCTTGTATGCGGATCATTATATA TGTTCTCAAACTTGGGTAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2930: (16 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
1435251
281213889970H21275AS3ISB171SLBrugia malayi infective L3 JHU93SL-BmL3
4458691182886N44367SW3ICA1205SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5594421345263W51550AS4SLC641T3Brugia malayi L4 JHU93SL-BmL4
5594521345273W51560AS4SLC686T3Brugia malayi L4 JHU93SL-BmL4
7471741660784AA109327MBAFCE0D07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8002551737638AA161602MBAFCF7B07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8557921817195AA216491AS4SLC687M13RBrugia malayi L4 JHU93SL-BmL4
8809671870951AA241646MBL2SJ2H8T3Brugia malayi second stage larvae JHU96SL-BmL2
8982411892846AA257370MB4SLM2A11T3Brugia malayi L4 JHU93SL-BmL4
8987421893347AA257831MBL2SJ4A8T3Brugia malayi second stage larvae JHU96SL-BmL2
9164251917045AA275410MB4SLY1C01T3Brugia malayi L4 JHU93SL-BmL4
10989302168100AA454431MBAFCX1E08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536582246872AA508995MBAFCX6A07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537082246922AA509045MBAFCX6F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12652162402587AA588924KJ4SLB216T3JHU93SL-BmL4 (JHU)


Date: 18:51:58 on Sat 18 Nov 117.