CBrugiaQ_2938


Sequence

>CBrugiaQ_2938 (14 EST) Length=619 GTCGTAATGTCACCCAAGTTTGAGGTAAATTGTGGAAATTATATCACGTAAGAGTATTGCTACAGTTAATAATCGTCAAT TATGGGTCGCATGCACAATCCCGGCAAGGGTATCTCACAGTCGGCGTTGCCATACCGTCGATCGGTACCAACTTGGCTTA AGCTTACAAGTGAGGAAGTTCAGGAGCAAATTACACGTCTTGCTAAAAAGGGTTTACGTCCCTCACAGATTGGTGTAATA CTGCGTGATTCACATGGCGTTGCCCAGGTTCGACGTGTTACCGGTAACAAGATTGTACGCATTTTGAAATCTAAAGGTAT GGCGCCTGAAATCCCGGAAGATTTGTATCACCTTATAAAAAAAGCAGTTAATATTCGCAAGCACTTAGAGAGAAATCGCA AGGACAAAGACTCAAAGTATAGACTGATTCTTGTCGAATCACGTATCCATCGCTTGGCTCGATATTACAAAACGAAACGC CAATTGCCAGCCACGTGGAAATACGAATCATCAACGGCGTCAGCACTTGTTTCATAAAGTGAATAATTCCGTTTTGCTGT TGTCAGTTTACTTCTCTTTTTTTGAGAAAAAAGTTTTTTACGAAATAAATATTTGCTTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_2938: (14 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217656808478R47591AS3ISA013SLBrugia malayi infective L3 JHU93SL-BmL3
4449881172370N43487AS4SLC841T3Brugia malayi L4 JHU93SL-BmL4
4451991182226N43698SW3ICA729SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
6826291549457AA056830SWMFCA551SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
7523111668295AA114399MBAFCE4B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8808651870849AA241461MBL2SJ0E9T3Brugia malayi second stage larvae JHU96SL-BmL2
8986021893207AA257639MBAFCZ3D3T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9214561923307AA280446SW3ICA2606SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10751722113649AA430853RRAMCA328SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10988282167998AA454329MBAFCX0C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11887612289625AA542713MB4SLY2D07T3Brugia malayi L4 JHU93SL-BmL4
12652322402603AA588940KJ4SLE019T3JHU93SL-BmL4 (JHU)
13736212629536AA668037MBL2SK1A09AT3Brugia malayi second stage larvae JHU96SL-BmL2
13860462660408AA680460SWAMCA3038SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:20:54 on Wed 22 Nov 117.