CBrugiaQ_2944


Sequence

>CBrugiaQ_2944 (2 EST) Length=331 GTTTGAGGTGTTCACACTGCTGCACCTATCTGTCACTGTGGCTAGTGCATTCCAATCAGTGGGAGATGACCGACGAGGAG CATTCTGATTCTCGGACAGAAGACGACTATGAAGAAAGCGAAGAAGCATATGATGATGAAGGTACTTTAGACGAAGAGGA AATGTTGCATCCAGAAGAGAACTATCAAGATGAACTTAAAATGCTAGAAGATGATGCAAATTTATCAGTGGAAGAATTAA GACAAAAATACTGCAGCGTTGTTGCCGATGAAGAGTATGATGATACTCAGTCGGCATCAACATCAGATGATACCCGTAAA TCTGAAAGTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2944: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6364461486211AA022429SWMFCA609SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10483092064956AA406964MBAFCZ7D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 7:22:3 on Sun 19 Nov 117.