CBrugiaQ_297


Sequence

>CBrugiaQ_297 (3 EST) Length=719 GGGCGGTGGAATTTGGNATAAAGGTTCCAAAATTTTTGCCTTCTTGTCAGTTAAAGTGGTTCNATGGNTGCAAGGGGTTC TTCAATTTTTCAATCAAATTCATCCNGCGTANGANGGACATTGGTTTCAACAGTGCATATTCNGCCAAGGTTGGANGAGT GCGAGATTTTTCCGCCCTGTAAGACTGAGCAATGGCAGAAGAAATCACCAAGAGTGGGAATACAAGTATCTAGATAGAGC TGTGATGACTGCGTAAGAAAAGATTGCTCACCAAAATAATCCAGATTAAATAACGTTGATCCACCTTCTACCTGCGTTTG CACTAAAGTCGGTGGTGCAACTTCCAAATAGCCAGCATTATAGAAATGTTCCCGCATTGCTCGAGTAGCAGCTGCTCTCA AACGTAGCAATGCAGCAGCATTTTCACCTCGAATAACCAAATGTCTATTGTCCAACATTTTGTCGACACTTGCTTCTTCG TTTAACACATTATCAATGCCTCCAGGAGGTGCATTTCCTATTATTTTCCAAAAATCAGCTATTAACTCGTGCCCGTTCGG TGCCTCTTTACCTTCCGGAACTTCCTTTATTGCGCCGTATATCTCAACCGTGCANTCAGTATTCACAGTGAGAGCGTCAT ACGTCTGGCACAATTTATCCATGAGTAGTACTTGAAGGAAACCAGTCCCATCTCGAAGGATGAAAAACATCAGTGACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_297: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7473241660934AA109438MBAFCE2D04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8981111892716AA257188SWMFCA1476SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10614422078592AA417421RRAMCA1406SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 19:41:27 on Mon 20 Nov 117.