CBrugiaQ_2993


Sequence

>CBrugiaQ_2993 (19 EST) Length=1157 TAAGAATTAATTTTGGGGGGATTGGGGTCCCGGCCCCCCCCCGGGGTTTTTTTTTTTTTTTTTTTTTTTAAGGACAACTT GGTTTATTTGTATCTGCAAATTTTTGAACAATAAACGAATATTTAACAATTACAGATACACTTCTATGTTCTTCAATAAG GGGGTATTTGTGGCATCTGACCCGGCATCGGTTGTAACAAATCCTTCTTTTCTTGTTTATGTTCTGATTCTGGATGCAGT GGATTCGGTGCTTCATTCGGTTCTTGGATATGAATCTGGTCAGGCAATGCAATACGTGGTCCCATATTTCCTTTAGGGTC GTGTGGCAGCATTATTTTCACTTTGATACCCAAAACACCTTGACGGAGTTGAACGTGACGTACTGCCTGTTGGATGTAAT CGTTTACCGGTTGACCAGAATGAATCATCAATCCATCAACAAATTTCATCGATTTAGCTCGCTGACCGCGCAGCTTTCCG GATACAATTACTTCGCATCCCTGAGCATTGGATTCCATAATAAAACGCAACACACCATAGCAAGCTCGACGAACAGCTAA ACCACCGACCAGTTTGTAACGTAACGATTCGCACTGAGCTACAGCGCAAAGACCGCGATTTGTAACTTTTTCCGCGTAAA GCTCAACTGTACCATCAGCAAATCCAAATCGTTTCTGTACAACCGATGTTAATTCACGAATCCGCCGTCCACGTTCACCT AACACACTTTGCGTACGTGTAGCCAAAATGATTATCTCGGCACGTGCCGGTGTTCGCCGAACTTCAACACCCGAATAACC ATCTTCGGCTAGTTCCTTCATAAGGAAATTATTTAATTCAGCTTTGAAAATACCATCCTGCACCGCCTTTCGCTTCTTTG ACATCTCCTGCGTTGTGACTATCATTGGGCTTTTTCTTCTGTCTCGTGAAATTAAAATACCTAACTGTAGCTACCAAGAT TACCTCAAACTTGGTGCCGAATTCGGCACGAGAAAAGAAATTACAGCCGAAAAATGCCAACTTAAAATGAAGTACACGGT ATGTATTGGGTAAATATTAAGTCCTGTCCTACACTGACGTTTTATATGCTTTTGACGAATATTGCATTCGAAGTATTATT CATCAATGATGTTTGATTAAAGAATAATGTATTTAAN


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_2993: (19 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
3939601081949H91519SWMFCA103SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4385201158269N37127SWMFCA248SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4385211158270N37128SWMFCA249SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
5304841300234W23380SWAMCA705SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7272061634851AA089372SWAFCA73SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7522701668254AA114423MBAFCE3C01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8196061763787AA180582MBAFCF7G12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8987071893312AA257731MBL2SJ3F6T3Brugia malayi second stage larvae JHU96SL-BmL2
9215011923352AA280491SWMFCA2182SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9215081923359AA280498SWMFCA2196SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10989482168118AA454449MBAFCX1G07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11160692199210AA471446MBAFCX2F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11163182199459AA471695MBAFCX5E07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11537052246919AA509042MBAFCX6E10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539092247123AA509246MBAFCX9A06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539162247130AA509253MBAFCX9B01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539322247146AA509269MBAFCX9C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539332247147AA509270MBAFCX9C11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813682655488AA675782MBAFCW4G02T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 5:10:46 on Sat 18 Nov 117.