CBrugiaQ_2995


Sequence

>CBrugiaQ_2995 (3 EST) Length=338 ATGAAAAGAACAATTTATTACTAAAAAAATCCTTTTAACAAACACAACATGCTGCGAAATAACTTTTAAAAAACTGTCAT AACTGTGAATTTTTTCAATGCAATTCATGACGCCTGCATAAACCTTGCTTGACCGGCCGACCACCCACCCCCATATGACA ACACTACTTTTTCTTTTTTTTCAGTTCTACGTATAATACCAGAAAAAAAAATACACAAAACGGTTAAAACTCATCTCCCA TAAACCGCAAACATAAAACTTTGAAAAGTTAATCACAAAACCGCAACAGGCAAAACAAATGTTGTGAAATTAAAGAAATG ACCGCTACGTCGGAAATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_2995: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
350181988812H48971SWMFCA018SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4384921158241N37099SW3ICA612SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7620381681906AA123595MBAFCE8D03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 14:17:27 on Sat 18 Nov 117.