CBrugiaQ_2998


Sequence

>CBrugiaQ_2998 (3 EST) Length=323 CCCCCTCCCCTGGCTCGTAGCCGCTCGTGCACGACTTCGGCAAGAGGTCGTGTCGATTGCAGCATGAATCAATCAGCACT TCTCATTATCTTTTGGTGAAAATGTTTCTCAACATACAGATGAAACAGTAGAACTAATTTCGGCAGCAGGTGGTTCNACC AGCGATATCCCAGAATCACATGCGGNGTTAATTCAGACAAATGCGGATGTCGCTAATACTTCAACCGTTGTGCAACAACA TGCTGAACCCACACAGGTTCCGCGGNGCATTGGCCAGAAGGCCAGCAGCAACANTGCGCGACTCGGGGCGANTGCGCACC AGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_2998: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
296624905428H35929SWAMCA204SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5304791300229W23375SWAMCA700SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5407031313881W32851RRAMCA1232SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 17:45:2 on Mon 20 Nov 117.