CBrugiaQ_3


Sequence

>CBrugiaQ_3 (3 EST) Length=918 NCACCTNTTGTCAGAAAANATGGGTTCCNGTTTTCAAANTTTTTCATTTTTGGTTTGGTAATTTCAAATTTTTCAGGAGA AAGGNTTCANGTTTTATGGGTTTTTCAATATTCACCGGAAATTNCGNGNGGCATTTTGACCTTTGGGAGGGGAAAGTTCN AAAAAGGCAATTTTTGGCATTTTGGANAAAGGGGGNGGCATAGNTTGGATTAGCAACAGAACAATTGNGGGGCATAGCCC TTNATTCAGAAAATTTTAANGTAACNGATTTTCCCAGGNGNTTTTCAGTATATTGACANCCTTGAANGGGGTANGTAANT TTACCCCGGAANATTCAGTTATTNNGGATTAGTTTNGCCGCCTTCAACAACCAATATTCAGCCAAAAAGTCNGCTTNTGG TCCAATGANTTTGGAAGACATCGCTGTTTTCGCAGCTTCAGTAATNGAATGTTGACCCAGNTCCCGTGATCCAAATGACA AATTGTCCTGCATGTAACGCACAGACTCTTTACAAGCTAGGCGATAACCGTTAATAACAGTCGTAGGATGAACTTGCTGC TTAACTAATTCATCAGCAGACTTGAGTAACTCTGCCGCCACAATAACTACCGATGTTGTTCCATCACCAACCTCCTCATC TTGTAACTGAGCCAATTCGACAAGAACCTTCGCAGCTGGATGTTCAACTTCTATTTGTTTAAGAATTGTCGCACCATCGT TTGTCACTACTGCATCTCCGACATCATCCACAAGCATTTTGTCGAGCCCAACTGGTCCAAGTGAAGACTTGACAATATTA GCTATCGCCGATGCAGCCATAACATTTTGTGTTCTGACGGACTGACCCGAAGTACGTTTGCCCGTAACAGCAAGAATCTT TCGCCACCAGATGCCATCTTTCCTCATACCGAATTCGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_3: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
291549902081H30925SW3ICA144SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10481352064782AA406790MBAFCZ4F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10797492140369AA435455SWAMCA1587SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 4:23:28 on Thu 23 Nov 117.