CBrugiaQ_30


Sequence

>CBrugiaQ_30 (2 EST) Length=876 AAAATCCAACCTAAAGAAATTAACCACACCCAAGAAAACACAAGGAGCAAATAATCACAGACCAGCAAACCAAAAGAGCA GAAACACATACACAGAAACACAGACACACACACCAAGCAAGCAAGCAAGCACCCCACAAACACTATTATAACAAAATAAC AGGAATTAAAAAAACACTGCTCATTGATGTCTTTCACCACCAATAAACTCAATTCCTCAATAAAAATGACACAGACAAAC AAAATGGATTTGAAAAACACAATTTCTCTTTTTGTTGTATCCAAGAAACACACCTCAACTTCAAGGATAGACATCATCAC TGGGTAAGAGGATGGAAAAAGATATTCCAAGCAAGTGGACGCTCATGTGGCTGCTTTCATATCTAACAGAAAGAAGAGAC TTCAATCCAAAACTAATAAGAAAAGATAGGGAAAGGACACAAAATATTCATAAAAGGAAAAATCCACCAAGAAGATATTG CAGTTTTTAACATCTGTACACCACACACAAAGGACACCCAAGTTCATTAAAAGAAAACTGTTACAGCTTAAATCACACAT TGATCCCCAACATACTGATAGCGGGAGAATTCAATACCCCACTTCGGCCAACAGAAAGGTCATCCACATAAAATCTAAAC AGANAAATGCTAGAGCTTACTGGACATTGTTAACCAAATGTTCTAGCAGATATTACCGANANANATGTTCCTCCAACCCA AAAGAATGTTTCTTCTTCTCAGAANCCNTGAAACTTTTTCCAAAATANAACGCTTNCTGGACGAAAGCCANTCTGACCGA TNCAAAAATTAAATGCTNCCTGTTTCCCCCGAACCTCNGGATTAACTGGTTTNACATNCCGAACCNCGAAGCCTCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_30: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8855581876962AA246154SWMFCA1636SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
12774632429605AA598353SWMFCA2995SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 4:34:50 on Mon 20 Nov 117.