CBrugiaQ_3015


Sequence

>CBrugiaQ_3015 (2 EST) Length=296 AAGTGATGTATGAAAATGTACCTATGGAAACTGAAGAAAAATCAAAGAGAAAACGGGGGAGAGCGTGTGATCACGTCCGG CAAGCACTGAAAAGATGCCTTAGAGAATCGGACTGTGTACAAAAGGAGCATCGCCAAGCAATGGATTGCTTGCGCTCACA TGCTGATAGTGTTCCGGCTCGATGTCTTCAATTATTAGATACATTCGCTCAATGTAAATTATCCCTCGTCAGCCTTAGAC CTCTGTTTCCCATATTTCTGTATGTATATCCAAGGAATAAACTGTAAGTAATGAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3015: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
281200889957H21262AS3ISB178SLBrugia malayi infective L3 JHU93SL-BmL3
7159251620782AA080687RRAMCA241SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 14:55:27 on Wed 22 Nov 117.