CBrugiaQ_3019


Sequence

>CBrugiaQ_3019 (2 EST) Length=320 TTTCAAGGGGAAAATTATTTATCTACTTGACAATACTAAGAAATGAATATCAGCAGCGAGTGCACACGAACAAATACGCA TACCATGTTTGATTGCAACTCACATGTTTATAACATTCACAAAACAGCAAACTTGTAGNATAATACATTTACCGGATAGA AATGGGAGACAAAAATATGATTTAAAAAAAAAATTCGTAAGCAAAGTACAAATTAACCCAACATATAAGAAATGAAGAAA GAATATTTCACTACTTTTTCGAACTTGGACATCAAATACAATCAGTTACCAAACCAAACACGTTATGGTACTAAANAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3019: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4446901167587N43205SW3ICA1127SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8963381890018AA255415SW3ICA2455SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:20:54 on Sun 19 Nov 117.