CBrugiaQ_3020


Sequence

>CBrugiaQ_3020 (10 EST) Length=356 TTTNNTAGAAGCAACCAATTTACTTTCCCCATGCAAATTTAAATGGAACTCTACAAAACAAACAATTTAAATTGTGGATG AATTTTGAACACCGTACATCTGCAATCATCATCACCATATACAAGCACATAAAACTTGACCACGATGAATGAATATCTAG AGAAAAACCTGCTAAACAAAACAGTTTTTCACTTACAAAATTGGGAGTGACGAGGAGGAAAAGAGCTTTCCTCATATATG CTGTATGATGAACAAAAACAATTGCAATGACGAAAATGGAGACGGAGACCTTCCAAATCATCAACAGACCGAAANCNTNC AGCCCGGGGGATACACTAGTAATTGAGCAAATTTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3020: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5362421309122W29138RRAMCA1325SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7620531681921AA123630MBAFCE8E08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8428401799505AA203762SW3ICA2036SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8985011893106AA257539MBAFCZ2B12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985331893138AA257661MBAFCZ2F1T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10480142064661AA406643MBAFCZ2F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10777392130922AA433445SW3ICA2221SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
11162202199361AA471597MBAFCX4C12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11938462314998AA547797MB3D6V1A03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13667782605316AA661272MB3D6V4H11T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 20:55:47 on Wed 22 Nov 117.