CBrugiaQ_3036


Sequence

>CBrugiaQ_3036 (3 EST) Length=339 GGGAATGGGGACCCGGCCCCCCCCCTGGGGGTTTTTTTTTTTTTTTNTTCGCGTCAACAAATCGATANACACATACACAC CTCAAACTGTGGTAATTAAACCCGGAATTCCGGGTTTAATTACCCAAGTTTGAGAGGATTTTGAAATAATCTTTTTTCAA AGTCTGCGTTGTTTTCCCTTTCATTGAGCTACTTGGTATCCCAACCTTCGTTATTACTATCTCAGTGCTACAAACTGCTA AGGATGAATCTGATAGTACTCAGTATTCTACTTATCACGCTATTCCAGCAGCAATATTTCGCCCAAGTAGCACCTCCTAA CGATCTTTTCTATGAATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3036: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
216944806472R46879AS3ISA004SLBrugia malayi infective L3 JHU93SL-BmL3
4448911172273N43390AS4SLC472T3Brugia malayi L4 JHU93SL-BmL4
8810531871037AA241438MBL2SJ9A4T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 4:15:4 on Wed 22 Nov 117.