CBrugiaQ_3043


Sequence

>CBrugiaQ_3043 (7 EST) Length=907 CAAGTTTGAGGGTCCTTTAAGGGTCGAGTAAAGTAAAGAGTATAAAATATGGCTCGTGGACCAAAGCGACATTTAAAGCG CCTTGCAGCACCGAAACATTGGATGTTAGATAAGCTTGGAGGTGTTTTTGCTCCCAGACCAAGGTGTGGACCACATAAAT TGCGTGAATCGCTCCCGTTGATATTGTTTTTGCGTAATCGACTAAAGTATGCACTGACATATAATGAAGCGCGCATGATT TGCAAACAGCGTTTAATCAAAGTCGATGGAAAGGTGCGAACAGATATGCGCTTTCCTGCAGGATTCATGGATGTAATCAG GATCGAGAAGACAAACGAGACTTTTCGCTTGTTGTATGACGCAAAAGGACGATATGCTACCCATCGTATCACAGAACAGG AAGGAAATATTAAACTGTGCAAAATAGTGAAAAAATGCGTTGGGCCAAAAAGGCGTACCTTTTATTGTTACCCACGATGC TCGAACCATCCGGTATCCAGATCCTCATGTTAAGGTAAATGACACAATAATGGTGGATATTGCAACCGGTAAAATGAATG ATTACGTTAAATTCGACCAAGGTAATTTGTGCATGGTAACAGGTGGACGTAACATGGGTCGTGTAGGCATTGTTGGACAT CGTGAGAAGCATCCGGGCTCATTTGATATTGTGCACATTAAAGATGCTGCTGATCATTCGTTTGCCACTCGGTTAAATAA CGTGTTTATTATTGGAAAAGGAACTAAATCTATAGTAAGCTTACCAGGGCCGACGAAAGGTGTCCGTTTGACTATTGCCG AAGAACGGGATCGTCGGCTTGCACAGAAAAGAGCTGCTTAGATCAATTTTGTTGACACTTATGTGATTTAATTGTACTGT TCAATTCGTGATTAAAATACATGTTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_3043: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
354093992867H52871SW3ICA412SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3939481081937H91507SWMFCA091SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8001201737503AA161697MBAFCE8F01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8197281763909AA180691MBAFCG3C10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8639511845399AA224618SWMFCA1046SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11163232199464AA471700MBAFCX5E12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538662247080AA509203MBAFCX8E05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 4:25:21 on Wed 22 Nov 117.