CBrugiaQ_3050


Sequence

>CBrugiaQ_3050 (2 EST) Length=312 CGGCTAACGCCTGGATTTTGATTATATAATACGAGAGTCACTATTTATGTGGAATTAGCTCGATGCAGGAGGAGAAAGAT ATTTGTCTCGGACCTTATAGAACAAGGTGTCCCTACAGCTGAAGTGATGGAGAATGTGGAAGCTTATTTAAAAAAAGATA GGCAATATCGGCATAGAGGAAGGCATCAGAACGTTTAGAAGCAATTTATAGAAAGTATAAGCAGGTTGAACAGCAACTAA CTGAACAGAAATCACATTTAGTTTCGAAGCTTCCAAATTTGGAAAAGTCAGTCAGAATTATTAACCATTTAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3050: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8809201870904AA241612MBL2SJ2B9T3Brugia malayi second stage larvae JHU96SL-BmL2
8811081871092AA241631MBL2SJ9F5T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 6:54:3 on Sat 25 Nov 117.