CBrugiaQ_3080


Sequence

>CBrugiaQ_3080 (2 EST) Length=315 CAAAGATGACAATTTATTGAAGAGAAGTTAAAGGACATTATCATAGATATTTCATAGAAGAAGGGTTGAATAGAAGTCAG CTATCATAGATATTTGATAGAATTTGTTGGTTGGATAAATTCTGGTAGTTGTTTTGCTGGAAGAGAGCGTCCTCATCGTA TCCCGTTCTTCCTTTTCGTTGTTTCCACATCTCTCCCAGTAGCCCTCATTCCCTTTAACTATCATACCATCTTCAACCGT TTATTCCTATTCTTTTTCTTTATGTATACTCTTTTCTTCCTATGATTGCACTTTTGGAAATTCTCAAACTTGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3080: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4448881172270N43387AS4SLC481T3Brugia malayi L4 JHU93SL-BmL4
8986131893218AA257650MBAFCZ3E5T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:6:29 on Sun 19 Nov 117.