CBrugiaQ_3094


Sequence

>CBrugiaQ_3094 (2 EST) Length=453 AAGAAATCTGTATTTAATGCATAAGAGTAACTATTAACATATTTGTAAAGTACAAAGTAATAAAATTTATATCAGATGAG ATTTCAAGCAAACACATAAGAATATGGATTAATCACTTAATGTGAATGCTTAAATATGACAAAAAGTGAAGAATCAACTC ACTGTATTATCTCCTTAGAAATTTCATTGATGATTCTACTTACAGGAATAATTTATAGATGTCTAGGAAAGTTAACTGCA TGAATCTAACAAATTATAATGACAAAATAGTATATTTCAGATTTCAATAATTACTGAGAACATTGAGTGCTAATTTTATG GCATAGCTTTGATTCTAGCCGTTTGTTCTTCAAGCTCCTTTGCGATTTCGGGAGGAAGATCTGAGCCAACCTGCTGTTCG AAGAAATGTTTGGTTTCTTCCATATCCTCTACCCAATACTTTTTCGGTAATGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3094: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939722315124AA547923MB3D6V2H01T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13667002605238AA661194MB3D6V3H12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 4:17:30 on Mon 20 Nov 117.