CBrugiaQ_3099


Sequence

>CBrugiaQ_3099 (5 EST) Length=446 TGGGACCGCCTGGTGAAGCAGGACCACCTGGAAAAGACGGAGAGAAAGGAAAAGGTGCACCAGGACCTCAAGGACCACCC GGACCACCAGGACCACCTGGCCCTCCTGGTTTGGATGGCGAAAAAGGAGCAGATGGACAACCAGGTCCTGCAGGACCAGC CGGCCCAACAGGAAAAGATGGATATGCCGGTGAAGAAGGCAAACCTGGATTACCTGGTGGACCCGGCCTTCCAGGAAATG ATGCAGCATATTGTCCATGTCCACCACGTTCTGCTGTATTCATCAGTCGTTTCACTCAGTGATGAAAATTTTTAAATAAC TTTCAAGAAGTCTACAATTAAATCAGCTGTAAAAGATGAGTAATTACACTATTGTCAGTTACATCATATTTTCAAAATTT TTTTGTTCAAAGAATGTTTAGAATTCAATAAAGAATTCTATAAAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3099: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304531300203W23349SWAMCA491SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
12617022392898AA585486SW3D9CA019SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13666382605176AA661132MB3D6V3B02T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13667152605253AA661209MB3D6V4B07T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13870892663029AA681024SW3D9CA562SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)


Date: 12:1:23 on Wed 22 Nov 117.