CBrugiaQ_310


Sequence

>CBrugiaQ_310 (2 EST) Length=845 CTACATTGGATCGCTTCTGATAGGGATGAAACTGCTCCATCTACTNGGTCTCGACACCGGTGGATGAAATCTTCACAAAT AATAGTTATGCTAGCATCTCAGACAATTTCGATACCCTTGATTACTACAATTTTGAGCCATTGTTTGGTCCAAAATTTTC GTTTGATCCTTCGCAATTCATAGATTTCGCTCAGTTGAGTGAAATTGAGGATATAAGCNGTAAAGAATCAATGACGCGAA GCTGATCAGATCACAGATACTTCTTATCCTGGCTTTTCACATAGCTAGGATTTCATCGGCCACNCTAATTCGGAGTCATC ACTGGGCTCATNATATGGATTCATACAGGAATGTGTGGAGAGAGGGTAATGGAAAAATAAGAACGAATGATGATTAAGTG CGACATCTTTCTATTAGAGATGCTGAAAGTAGAACTACTTCGCCACCTAATCTCGATCAGCGATGACATTGTCACATATA TGCACTTTCCTCATTCACAGGCAAAATGCTATTCCGATCTATCTGGGACCAACTTACTCTTTCCTCGGGACGACACATCC GGTCAACATGGAGCTGCTGAACGGTAGATACCTCCGATCTAGCACAGGGGAAATACTGGTCCAAGAACCAGAAGACGGTG ATCGCCTAAGTTTCAGTATCACTGGTTTACAAAATCCCATTCCGATCTATTNTTCCTCGNGATGACACATCCAGCCAACT TGGGAAATGCTGAACAGAGGGTCATCGATTACCACCGGGGGANGTGCTGGGTGGAGAATCTGAAACAGATTAGAGATATT ATTATTGTCCATTGTCGCGGGTGTGGCTATTGATCACGAACAGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_310: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11587722252949AA514132SWMFCA2234SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11919072307149AA545858SWMFCA2400SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:48:15 on Fri 17 Nov 117.