CBrugiaQ_3103


Sequence

>CBrugiaQ_3103 (26 EST) Length=2512 GGTATTCCTCTTCCTGCTTCTTAACTTCCTCAATCTCAAGTTCCAACTTGATTCTTTCTTTGTCGTCCAAATCACTATTT TTTAACTTCTCTTGTACTTCCAGTATTCGTTTTTCCACAATTGACTTTCCCTCCATTAATTTCTCCTTTTCCTGTTTACG CTCAGCCATTCGTTCCAAGCGTGCCTGATGTCGCCATCGAAACAGCGAAGGTGTATCGATGTTCGGATGTGTGTCATCCT CATCATCTGATACTTCGATCGTTTTCCACTTGGAATAATCCAATCTCGTGCCGAATTTGAGGCGTGCTCGTTGTTGATTA TTGCAACGTTTCTCGAAATACAGCAAATATGTCAAAGAATGCCATTGGTATCGACCTTGGAACCACGTATTCCTGCGTGG GTGTGTTCATGCACGGCAAAGTGGAAATCATTGCTAACGATCAAGGTAATCGTACAACACCATCATATGTTGCATTTACC GATACTGAACGTCTTATTGGCGATGCAGCCAAAAATCAAGTTGCAATGAATCCGCACAATACTGTTTTCGACGCTAAACG ACTGATTGGTCGTAAGTTTGATGATGGATCAGTGCAATCGGATATGAAACATTGGCCATTTAAAGTAGTGAATGCTGGTG GTGGTAAACCTAAAGTGCAGGTTGAATACAAGGGAGAGACGAAGACTTTTACTCCAGAAGAGATTTCGTCGATGGTTTTG GTTAAAATGAAGGAGACGGCGGAAGCTTTTCTGGGTCACGCGGTCAAGGATGCTGTTATTACAGTCCCCGCATACTTTAA TGATTCCCAACGACAAGCCACTAAAGATTCCGGTGCAATTGCTGGTCTAAATGTTCTACGTATTATCAACGAACCAACAG CAGCTGCTATTGCTTATGGTTTGGACAAAAAGGGCCATGGTGAACGCAACGTTCTTATCTTTGATCTTGGTGGTGGTACA TTTGATGTATCTATTCTAACCATTGAGGATGGTATTTTCGAAGTCAAGTCTACAGCTGGGGATACTCATCTCGGAGGAGA AGATTTCGATAATCGCATGGTGAATCACTTTGTTGCGGAATTCAAGCGAAAGCACAAGAAGGATCTTGCGTCAAATCCTC GTGCGCTTCGTCGTTTACGTACTGCATGCGAAAGAGCAAAACGGACATTGTCTAGTTCATCTCAAGCGAGTATCGAAATT GATTCATTGTTCGAGGGAATTGATTTCTACACCAATATCACCCGTGCTCGCTTTGAGGAATTATGTGCTGATCTTTTCCG TTCAACTATGGATCCAGTTGAAAAGGCACTCCGTGATGCTAAGATGGACAAGGCCCAAGTCCATGACATTGTACTAGTAG GTGGATCAACCCGTATTCCGAAAGTGCAGAAGCTCCTATCGGATTTCTTTTCTGGCAAAGAACTGAATAAAAGCATCANT CCAGACGAAGCCGTGGTCATATGGTGCAGCAGTGCAGGCAGCTATTCTTTCTGGTGATAAGTCGGAAGCCGTACAAGATT TGTTACTGCTTGACGTCGCACCGCTTTCACTTGGTATTGAAACAGCTGGGGGTGTTATGACTGCACTCATCAAGAGAAAT ACCACTATTCCCACGAAAACCTCCCAAACTTTCACCACATACTCCGACAACCAACCTGGTGTCCTTATTCAGGTTTACGA AGGTGAACGTGCTTTGACTAAAGACAATAACTTGCTTGGTAAATTCGAGTTGTCTGGAATTCCGCCTGCTCCTCGCGGTG TGCCCGCAAATTGAAGTCACGTTTGATATTGACGCCAACGGTATTCTGAATGTTTCTGCCCAGGATAAATCCACAGGCAA ACAAAACAAAATTACCATTACCAATGATAAAGGACGTTTGTCAAAGGATGAGATCGAGCGGATGGTACAGGAAGCTGAGA AATACAAGGCAGATGATGAAGCACAGAAGGATCGTATTGCGGCGAAAAATGCTCTGGAATCGTACGCATTCAATATGAAA CAGACGATTGAGGACGAGAAGTTAAAAGATAAAATTTCGGAAGAGGATAAGAAAAAGATTCAAGAAAAATGTGACGAAAC AGTTAGGTGGCTGGATGGAAATCAAACAGCTGAAAAAGATGAATTTGAGCATCGTCAAAAAGAATTGGAATCTGTTTGCA ATCCGATTATTACAAAACTCTACCAGAGCGCTGGTGGTATGCCTGGAGGAATGCCGGGTGGTATGCCTGGTGGAGCTCCA GGTGCTGGTTCAACAGGAGGTGGACCAACAATTGAAGAAGTTGATTAGATGATTTTTATGATCGGAATTGACGATCTCAT TTTCATTGCGTGATATTACCTCTCCCTCCCTGTTTTTGATGTTATGGAATTTCAAATTACTGGTTTCTTTGCAACCTCGT CTTAATAATTGAGGTGTGATTGGACTAGGCTGTATTTGGAAGTTATTTTATTGATTGTTATTGTTTCTTGACTTGGATTT CCGTACGATTTGTAATAAAGTTCAAGTATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_3103: (26 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217631808453R47566SWAMCA067SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
296634905438H35939SWAMCA226SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
4411301162900N39680SWMFCA256SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4445791167380N43075SW3ICA1083SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4448131167710N43190SW3ICA909SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4459331182950N44431SW3ICA1288SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4621681199683N56591RRAMCA104SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6000451416468W91801TEMFCA0047SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6722881537235AA052057SWMFCA784SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8675201849750AA228192SWMFCA1115SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8679341850699AA228576SWMFCA1306SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8712991854955AA232034SWMFCA1155SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8809391870923AA241657MBL2SJ2D9T3Brugia malayi second stage larvae JHU96SL-BmL2
8854711876875AA246067SWMFCA1175SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8944351887860AA253511SWMFCA1394SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8963051889985AA255382SW3ICA2422SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8981531892758AA257230SWMFCA1534SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8984191893024AA257522MBAFCZ1C2T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8986281893233AA257743MBAFCZ3F10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9140671911991AA273089SWMFCA1831SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
11161202199261AA471497MBAFCX3B10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11162402199381AA471617MBAFCX4F04T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538312247045AA509168MBAFCX8B01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
12617832392979AA585567SW3D9CA169SKBrugia malayi L3 molting-day 9 larva cDNA (SAW97MLW-BmL3d9)
13667432605281AA661237MB3D6V4E03T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
13814352655555AA675849MBAFCW5E08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:22:3 on Sun 19 Nov 117.