CBrugiaQ_3122


Sequence

>CBrugiaQ_3122 (3 EST) Length=525 AATGTACAAAAAGTTTATTTATGGAACTGTTGAGGGGAAAAAATTTATGTTAGTGATATATTGAGAGAAAGTGAAAGGGA AGGATAAAAGACATGTGGAGCTATAGAAATTATGTGACGTCATTCGTTAGTTATTGCAAGCTTTACGGCTCGTTGTCTAC GGAGGAAAAAGAGGTTCAAATAAATCCTCCCATAAGACGCTTCTCATTTCCATTCACTGCTTCTTCTGTTTCTTTCGTTT ACTACCTTTCTTTTTCTTTTTTTTTGAGNCACTTTTACTTCCTTCCATTCCTTGTGAGTCTGTTCCAGTTGACGGTGTTG AAATAATAACTTCGGGCGTTGGATCCATAGGTTTTGCGGTAGCGGATACATCATCACGCATTCCAACTGCTGCAGCAATA CCGGCAGCGCTCTTTTTCTTCACGACAAAATAACCTACGGCACCAACGACACACATAATTAGCAGTAGGAAAAAAAATGA CATCTTCGTCTTACTCTAACCAGATCACCAGTTATACTCTCTCNC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3122: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299941908745R47688SWAMCA145SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5801111382112W59898SWAMCA776SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7620351681903AA123592MBAFCE8C11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 8:28:41 on Fri 24 Nov 117.