CBrugiaQ_3127


Sequence

>CBrugiaQ_3127 (11 EST) Length=646 CGCAATACATCGTTTTAGCTATGGTTGAATGAAGTGCTCATAGTTCTCATTGACATGGTTGACATATCTGACATGGAGGA GGTATGTAACATGGACACAAACGACAACCTCCTGGTGTCACATGCGGAGGTGTCGTTGGTTTTGGAGTTAGCGGTGGTCC AGGAGTCCATCCTGGTGTCTGCGTGGGTGGTAACGTCCAAATCGGTGGTGTTGGCGTTTGTTGTGTTACCGTTGGCATAC AATCTGCACCGCCACAATTTATATTTATTATGCACCCAGCACACTTTTTATCATCAGCTTGTGGTTCGATGTATTGCGGT TGCATACCTTGCGGTTGCATACCTTGTGGTCGCATGCCTTGTGGTGGCATGCCTTGTGGTTGCATACCTTGTGGTTGCAT ACCTTGTGGTTGCATACCTTGTGGTTGCATACCTTGTGGTTGCATACCTTGTGGCAGCATACCTTGCGGTTGCATAATCT GCGGTCCCATTCGTAGTAATTTTATACTTTTCCGTTGCATTTCTTGTGGTTGCACATCCTGATAATGTTCTTCTTGCGGA CCATAATGTCCCAAATGCACTGCATTTGCTACCGATAAAAGCATGCAAAATGAAGGAATAAGCTTACAACACATAACTCA AACTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, Processing,


Cluster Information for CBrugiaQ_3127: (11 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
299937908741R47582SWAMCA104SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7244711631381AA088154SWAFCA017SKBrugia malayi adult female cDNA (SAW96MLW-BmAF)
7472901660900AA109299MBAFCE1H12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7619731681841AA123517MBAFCE7D12T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10482262064873AA406803MBAFCZ6D06T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10989422168112AA454443MBAFCX1F11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11536622246876AA508999MBAFCX6A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11538872247101AA509224MBAFCX8G07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
11539582247172AA509295MBAFCX9F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13813552655475AA675769MBAFCW4E09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814642655584AA675878MBAFCW5H03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 0:47:58 on Fri 24 Nov 117.