CBrugiaQ_3135


Sequence

>CBrugiaQ_3135 (3 EST) Length=303 CTTTTGTAAAGTTTCTATCGGAAAACATTTTGAAAGAAATGATTTGCCATAGACTAACAACAGATTTCATAAGAGGTGCT GTTTCATGTAACAGGAAGTAAGCGTAGATCGCTTTTTCCTCTTCTATAGTCCACATTTGGAAAGATTTAGTTCAATCGCT TCATCCTGCTATTTCATTTTCTAGCACTTTGTTTACTTTTGTATCTGAGGCGAAGCTGTGTCGTTGTTCTCAGTTATTTA GATATGACTTGATATGCTTTTTTTATTTTAACAAGCAAGGGAATAAAGTCTATTTTGCATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3135: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7471831660793AA109257MBAFCE0E07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
7472081660818AA109348MBAFCE0H03T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8675711849801AA228230SWMFCA1269SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:16:34 on Tue 21 Nov 117.