CBrugiaQ_3155


Sequence

>CBrugiaQ_3155 (2 EST) Length=350 ATTTATATCTACGAGACTCGCGGGAAGATGAGACGACTTGTATATCAAGTAGACGATCGAGAGGGAATTGAAGAGGTGGT CGTGCCACATAATAGACGAATTTGGATAACTGAAACGTATTTCTCTAATGCTCATGATGTAAATCATGAAAAACACCATC GAACGGTTGTCGAACCGACAGGATATGTTCGATCTTCCGAAATGCGTACAGTGACAGTGCCAGTGGAATACAGTTCAAAG TATCCGTTTGAAAACACTCGAATGATCAAATTAAGATTATCAAGTTGTAAGTGAAGAAATAAAATAAAACTAATGAAGAA ATAAAATAAAACTAATGAAGAAATCCAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3155: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
11939262315078AA547877MB3D6V2B12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6
11939642315116AA547915MB3D6V2G02T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 12:29:35 on Fri 17 Nov 117.