CBrugiaQ_3157


Sequence

>CBrugiaQ_3157 (2 EST) Length=301 CTGCTGAGAGAGTGCTCAATCATTGCTATAACTAGTGTCTGTCTCTTCTGAATATTAATGTCGGACAGCAACAGCACCAC CAAGTCTACGAATGGTACAATAATAAACAGCCATGCAATCAATCATAGACACCCCGAAACGCAACGGTCCATCAACAAAC ACACGTGAACGTATCTTTGGTATTAATGTGGAGCAAGTGACGCCTTCCAAGAAAGTATCAAATACTTTCAAATCGTCAAT TTTTGAGAATAATGCATCTGAATCGCCTACTCGAACACCTAAAAAGAACATACCTGTACTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3157: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8982501892855AA257379MB4SLM2B9T3Brugia malayi L4 JHU93SL-BmL4
8982511892856AA257380MB4SLM2B10T3Brugia malayi L4 JHU93SL-BmL4


Date: 23:36:33 on Fri 17 Nov 117.