CBrugiaQ_316


Sequence

>CBrugiaQ_316 (5 EST) Length=641 CAAGTTGGAAGGATATCGACATTTCGGGACAGTTCATCTCCATCCATCATTGTCGTGTGACTTAGGGTGTTAAACAATGG TGCGTACAACACTTCTAGCAAAGGTTGCCCTTTCTCAGCCATCGTTAATAGCTCGCTGGGACAATGTCTCACCAGCTGCC AAAAACATCAAATTTACTTATAACGGGAAGTTGGCTAATATGCTGCGGTATTATTTATGGTCATATGGCTGGAGCGGAAG ACGATATGGTTTGCTCTTTCATGATCAGTGTTTCGAGCCAGCTCCAGAAGTAAAGGAGGCACTACGTCGGTTTGAACTTG AAAGAACCATGGCTTTTTGGATGAACGCAAAATACGACTCTATCATGCACATACAAATGAAATCCCATGGGTGAACAGGT TACCAAAAGAAAAGTTGGACGAAGTGGGANGGATGAAACATGGTTTCTTTAAGCCATTTTTAGGATGAAANTTGGAGGAA GAAAAGAAGACGCGAGCCAACACTTCTGGGTTACTCCCTGGTTTTCAATTAAGAAAACGTCCTTAATTAGAATTGATGAT GATGTTACNTCTCTTTAAGTGTTCCTTTTCCATATACATATATCATTGTGTCCAGGATTTATTTAATTCCAAAGCATCTG G


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_316: (5 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217781808603R47716AS3ISB118SLBrugia malayi infective L3 JHU93SL-BmL3
217782808604R47717AS3ISB115SLBrugia malayi infective L3 JHU93SL-BmL3
343548973952R95222SW3ICA367SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4445741167375N43070SW3ICA1078SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12774502429592AA598340SWMFCA2973SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 18:59:44 on Sun 19 Nov 117.