CBrugiaQ_3175


Sequence

>CBrugiaQ_3175 (2 EST) Length=279 ACCCAAGTTTGAGGAAGGCAAAAAAAGCTAAACAGGAATTTATTAGTAGGTACTGCTGCTTCGGCAGCCGTACAGCAAAC ATCGACAGCAAATTGCTTGAAAACGACACAGTCTATGAGCAAGTATTCGGATACCGTAGCGGGAAATGAATCCGGTAATG TTACTAATATAATTGAAAATGCAACCGAAACCAGACAATCTGCAACTAGTGATAGTGAACAGTTTTAATGCAAAATCGAT TTTGATCTTTCATATGGCATATGGCTTCATTTCGTGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3175: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5595051345326W51624AS4SLC891T3Brugia malayi L4 JHU93SL-BmL4
8810841871068AA241685MBL2SJ9D3T3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 10:36:34 on Tue 21 Nov 117.