CBrugiaQ_318


Sequence

>CBrugiaQ_318 (2 EST) Length=630 GAGTTTTAAGGTCCCGTAAAGAAGAGTTGATGTGCGTCGCGGCATTTCTGTTGCATGACACATGGCTCGTATTGCAACAA TTCGAAATCAAATAGGAGAAATAAGCAGTGACGAAGCGTTGCAAAATGATTTAAAGATTTTGCCGTCGAATTATAATTTC GAGATTCCAAAAACGATTTGGAAAATTCGAGCCACAAAGAGCAAAAATGTGTGTCTGCAATTCCCTGAAGGACTACTCCT ATATTCATGCGTCATTGCGGATATTTTACGGAAATACACAAAATGTGAAATTGTAATTATGGGGGACGTCACATACGGGG CATGTTGTGTCGGTGATCAAGCAGCACGTGCATGTGGATGTGATCTTATGGTGCATTATGGGCACAGTTGTTTGATACCA ATTCCAGAAACTCAAGGAATGGAGATGCTTTATATTTTTGTTAACATCGAAATGAATGTTGGGCCATTTTATTGATGTTT TAAAAACCTATTTCCAAATAGCCTAAAAGCCTGGCATTAATTTAGCACCCACCAATTGGTCCCTTGCTTGCAAAATGTTN AAAAACAAATTAATTGGCAAAGGTTTTATATTTGAATCCCCCATTGAAACCCCTAGTCCCGGTGAAATCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_318: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
9214961923347AA280486SWMFCA2172SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13247192539362AA626975MBAFCW2A11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 11:59:41 on Fri 24 Nov 117.