CBrugiaQ_3213


Sequence

>CBrugiaQ_3213 (3 EST) Length=295 AAACTTTANACCACATTAAAGGGAACCCCNAGAAAAGGGAAAAAACCATNNAAATNCCCCTTGGTTTAAATAATTAAAAT TATTACCCCCCAATCCCAAACCCCCCAAATCCCNACCATTTAAAAAAAAACCACACTTAAACTATTCCGGACCCTCCAAG ATTAATCCAAACCACACTTATTAGGANTTTATTTTCCCCAATCCACCAATTTATTAGGAAAAACTATAGGAAAAAAATAA ATTAAAAAAGGGACTTAAAAAGGAAAAAAAAAAACTCGAGACTATTCTCTCGATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3213: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5305221300272W23409RRAMCA1300SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5678971366645W59854SWAMCA955SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
10774792125783AA433185RRAMCA1632SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 23:58:4 on Sat 18 Nov 117.