CBrugiaQ_3240


Sequence

>CBrugiaQ_3240 (2 EST) Length=291 TGATTAGCAAAATTTCACTCATTGCTAATCTTTTATCATTTCCGATTATTGCGATATTTTATTATTTGAAATTAAACAAA TATATTCCTTATTTGATTCTCTCTTTGCTGTATTATAAATTGCTGATGTGCTGAGCGCAGTGCAATACAGTTGTACCTCA CCATCAGATGTAAACATTGTTCGCTTCCATCTTTTTTTTTGGGTTTATTCCCATCCATCCTAGATGTCTTTTTTTNCCCC TTAAATAATGTAATCCCCCACTTAANTTTCTCCTTTGAGGGCTNCCTCACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3240: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5304641300214W23360SWAMCA509SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5441761318070W36324RRAMCA1361SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 1:25:45 on Sun 19 Nov 117.