CBrugiaQ_3252


Sequence

>CBrugiaQ_3252 (27 EST) Length=303 TTTTAAAAANATNACAATAAATTCCCNAAATACCATTNCATATAAAAACTTAAAACAACATNAAGGAAAAACCAAAAAAA AGGAAAAATACCATAAAAATCACCCTGGATTAAAATAATAAAAATAATAACCTCCAATTCAAAAACAACCAAAATCAAAA CAATTAAAAAAAAAACAACACTAAAACTATCCCGAACCCTCAAAGATAAATCAAAACCACACTCATAAGAACTTAATTTG CCAAAATCAACAAATTTATAAGAAAAAACTATAGAAAAAAAATATATAAAAAAAGGAACTAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3252: (27 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
309264924265H48213SW3ICA311SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
320246945447R86420SWAMCA397SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
343557973961R95231SW3ICA390SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
354102992876H52880SW3ICA423SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
3951001088237H92659SW3ICA518SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446921167589N43207SW3ICA1129SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4447701167667N43285SW3ICA754SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4706331215764N64882SW3ICA1347SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5123271278110W05372RRAMCA112SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5441861318080W36334RRAMCA1375SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5771411378353W69053SWAMCA1005SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462531502083AA032111SWAMCA1414SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462591502089AA032117RRAMCA161SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6462611502091AA032119RRAMCA173SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7061991592617AA072492SW3ICA1638SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7159351620792AA080697RRAMCA263SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7620931681961AA123666SW3ICA1712SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7621151681983AA123688SW3ICA1918SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8390211795686AA199943SW3ICA1972SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8390391795704AA199961SW3ICA1997SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640451845493AA224709SW3ICA2079SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8640551845503AA224719SW3ICA2165SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
8855561876960AA246152SWMFCA1633SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9141471912517AA273143SW3ICA2568SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10750612113538AA430781SWAMCA1789SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11587862252963AA514146SWMFCA2257SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
13667102605248AA661204MB3D6V4A12T3Brugia malayi day 6 post-infection third stage larvae SAW96MLW-BmL3d6


Date: 18:43:27 on Sat 18 Nov 117.