CBrugiaQ_3262


Sequence

>CBrugiaQ_3262 (2 EST) Length=281 GTTCGGTGATTTTTACATCACAAGCTTTCTCATGATGTTTATTTTGGGATACCATTTGAAAATAGACAGGTATTTTGATT CGTGGACTTTCAACAAGAAACGAAGTTGATTTTTCCCAGATCTTTTTGATTTGTCAACTTCATGTTTTCCTAGCACGACA TTAACTTGGAGCATTGTAATCTCCAAATTGTATAAGATAAATTAAGTGTACTGGTCAAAAAAAAAAAAAAAAAACCCCNG GGGGGGGCCGGGTCCCCATTCCCCCCNATNTTAATTCTTNT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3262: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5930921397362W84905SWAMCA1018SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
13860502660412AA680464SWAMCA3044SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 21:34:3 on Mon 20 Nov 117.