CBrugiaQ_3266


Sequence

>CBrugiaQ_3266 (2 EST) Length=282 AACCCATTNCTTTCCCCCCTTTTTTTTTTTTNCCCTTNGGCTTTNAATTTTAAAAATTATAAAAAGAGGAAACCCCCTTT TTAAAAAAAACTTAAGTTTTTAAAAAAAATTTACCACCCAATTAAGTCCCCAAAAAAAATTTAAAACCCCAAAAAAACCC CACCCAAAAAAAATTCCTAAAAAAAAAAAAAAAAATTAATTAAAAATTTACCCCAAAAAAAAAAAAAAAACTCGAGACTT TTCTCTCTCTCTCTCTCGTGCCCGANNNNNNNNNNNNNNNNG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST, Processing,


Cluster Information for CBrugiaQ_3266: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4445981167399N43094SW3ICA1103SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10751152113592AA430770RRAMCA1512SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:43:35 on Sat 18 Nov 117.