CBrugiaQ_3273


Sequence

>CBrugiaQ_3273 (2 EST) Length=285 CGGCACGAGTTTATAATGGTGATACTATGTTATTGGAATGTAATTCTATTTAATGTTTGTTGCAGAGATACTTATTGGAT TTGCTTTCTCAATTATTTCATTAATCGTGCATGCTGTAAGTCCATCTTTCTCTCCCATTTCTCTTATTTGGTCAGTCAGT GATTGTAGTTAGTTGATCAATCGTTGATTGTGATTTGTGTAATTAAATTAAAAATTTTCTGGTTTCATTTTTAAATTCAT GGAGATGTGTGTGCTTACTTTGTATATAAACGTTTCCGCTTCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3273: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8002651737648AA161612MBAFCF7C09T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10429802055211AA401610SWAMCA1665SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 5:48:27 on Sun 19 Nov 117.