CBrugiaQ_3275


Sequence

>CBrugiaQ_3275 (2 EST) Length=304 GGATAAAATTCTTTATTTTCAAAGCAAATTTTAGCAATAAAATCCTTGATCTCCTACAAATCGTTCACATGAGATTTACA ACATAACTGAAAACATCAGACATGGAAAAAGAAACAAAAACAGCCTTTTCAAAGCTAATCATTCAGACAATCAACAGACG TCTCGTCGAGCCAAAACAACAAAAAGTGAGGAGAAGCCATAAAACAAGCTCCACAACAAGGCTGGATTCAGTATTTTTCA TCGATTTAGCACATCATATCCTATCTTTCGACAGATCCATGTCTTGAGCCTTCTTTGGGAATTA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3275: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
5305051300255W23414RRAMCA1270SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8558121817215AA216475AS4SLC743T3Brugia malayi L4 JHU93SL-BmL4


Date: 2:58:10 on Tue 21 Nov 117.