CBrugiaQ_328


Sequence

>CBrugiaQ_328 (12 EST) Length=637 CTTTATTCATTGGATCAAAGGATAACAAAACAAAAAGTGGAATTTTATTTACAATTCATAACATTCACCACAAACAACAA ATACGGGAAGCATTGCACAAACATGAGAAATCTCCCAAGGGTTAGCACGACTTCATTAAATTGTGGCCCTAAAGGAGGCC CGTTGGGTTCTAGTGGTTGAGCCAAGACAGTACACGTACGCCACTCACTTCGAGCTAGTGTACTTCGTAACTGCCTTTGT ACCTTCCGAAACAGCATGCTTAGCCAATTCACCTGGGAGAATAAGTCGAACAGCTGTCTGAATTTCACGGGATGAGATCG TTGAACGCTTATTATAATGAGCCAAGCGACTAGCTTCCGCAGCAATACGTTCGAAGACGTCGTTTACGAATGAGTTCATA ATCGACATAGCCTTCGATGAGATGCCCGTATCAGGATGTACCTGCTTCAGGACCCGATAGATGTATGCTGAGTAAGACTC CTTTCGTCGACTCCGTCGTTTCTTATCGCCACTACGCGGCTTATGAGACTTCGCTGCTTTCTTTGCTCCTTTAGCTGACG GCTTCGGTGGCATTACTGACTAACAATAGGTCCTCGCTACTAACTAAGACGACAACAACCGAACACTCCAACACCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_328: (12 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4255611141662N27314SWMFCA233SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
4448651167762N43364SWMFCA380SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
5305111300261W23398RRAMCA1283SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
6186441463745AA007740SWMFCA421SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6676241537104AA051937SWMFCA709SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
6676301537110AA051943SWMFCA828SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8679301850695AA228595SWMFCA1291SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8944761887901AA253552SWMFCA1448SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9141081912478AA273104SWMFCA1932SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
9214981923349AA280488SWMFCA2177SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10987312167901AA454232RRAMCA135SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
11253612209429AA480731SWMFCA2090SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 17:3:58 on Thu 23 Nov 117.