CBrugiaQ_3281


Sequence

>CBrugiaQ_3281 (3 EST) Length=821 GTTGATGCATTAACCATAGAACCAAATGTTCCCAGCGGAGTGAGAGCAGACCGTTGAGCAGGGCATTCAAAGTGTACGCA ATGAAATACTTCATTCACTGAATTGTGCGTTCCAACAAGACGAATAAACACAACTGGAAGACGATCAAATCTCAAGATCT GCCATGCTCTGCAGTGCTCTTGAGTTTTATCAGCTATGCGTGTCCAAGATGTGTTATCACATGACACTTCAACATAATAT GAGTAATGACGATCTCGTGCCGCTCGTGCCGAATTCGGCACGAGCGGCACGAGTTTGTTCATTTATCTATTCTTAATTCT ATGTATATCTATTTTATGCCCTCTGTTGAATTTGTGGAAGGTGCAGTACATNACTCACAGTAGTATTATGCGCTTAATTA ATTCAGGAAAGAATTTGCATGTTCATGGAATTCTGGATTTTTTCTGAATTTCATTTTTTTTGTACTGCTANCAGCAACCA TGATTTGTTTGCACCATGCATTATATGTATATGAGACTATCTGCACACACACACGCAATGGCAATGGAGGCGACTTTGTC GTGTATTAATATCGTCACGATTTTCCCTCTCCTTTGGAATAATTTCTAAATAACTTTGGTTTATCGTGCTCACATAAGGA TTGGCGCCACTTTCTGAGCTAAATAGAAATATTGTTTGTTGATATGGTTATGATTTATTATTTCGTATGATGTCAGAGAA TGTTTTACTGTTTTGCAGGCGTTCTACTTTGTATGTGTGTGCGTACGTATGTACGTGTGTGCGTGTCCGTTTTGTTCGGA GTATTAAAAGTAACCTCATTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_3281: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7472631660873AA109403MBAFCE1E11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
9139561911880AA272953SW3ICA2390SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
10483182064965AA406700MBAFCZ7E01T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:55:37 on Fri 17 Nov 117.