CBrugiaQ_3283


Sequence

>CBrugiaQ_3283 (3 EST) Length=425 TTTGCTATTAAATTCTTTATTAAAACTCTACTCAATCCAAACTGAAGAACTCCTTATTCCATTTTAATATAAAGAAGGGA TGCAAAGACTCTCTAATTAATCTTAAATAGCGGAAACAGAAAAAACAGTCTAAGCCCCACATTAGAATAACATTCAGAAT TATTAAAAAACACTTACTGAAAAACTTCTAATAGAATGAGAAATAGAGTGGAAGATATGAAATGTGTGCAAGAGCTGCTT AATACATAATGTATATTCAAACAAACATTTAAAGCTCAGAAAACAAAATCATTGTGTTAACAGTAGTCCGACTCAACCTA CATTTAAAATTGCTGAGCACACATGCCAATATTTCTAAAATGAAACAACATGCTTAGAAAAGTGAAACAAAATTCATATG AAATTAGAATTGCCAGGAACATTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3283: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
7061961592614AA072489SW3ICA1635SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
7641171685433AA125655SW3ICA1924SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
12354402369535AA584982SWMFCA2795SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 16:55:52 on Thu 23 Nov 117.