CBrugiaQ_330


Sequence

>CBrugiaQ_330 (3 EST) Length=646 TGACTCTTCAATTCAAATTTGCGATGGAATTGGCATTAATTCCTCCTCTTCATCAAGAACAGATGGATGCATCTGCCNGG AATTATAGATTTCGCCATAAGTTCNTTCACGCAGACGGTTCAGTAATTCCTTTCNATAGCGTGTCCAATTTAGCAGCAAT CAGGCCTNTTCTTCTCGTCTAACTTCGCGTCTTTCAATCTTTCGCTGTATNGGGATAATTTTTTGTTGTCTTTCTGGAAG CTTCATCTTCTTCATCCTGATCAAATATTGATGTATGCGAATTAGACGTGCCTTGCATTTATGTCTAACATATTGAGACC AATGGAGTAATGCATCACCAATCTGTCTAACAGCTTGAGTCATATTCCGAGATAATTTGATCCGTTCCCAAAGTCTTCGT GGATAGTGACTTCTTTCAATTACCTTCATATATAGATAACATATACCTTTCTCCTCCCGAACCGTAGCATACTGACTGTT AGCTAACGGACATGATGCTCGATTACACAGACCCGTTAAATTGTACTCATTGCGACAAAACTTCTGCGTTTTTATCCTTG TTTTAAAGGAGCACATTCCCTTGTTGAGAATATTCCACGTAACATCATCACACTGCATCTCTTTACGTCTAACTCCAAAG TTTATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_330: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713641855020AA231979SWMFCA1374SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8855071876911AA246103SWMFCA1561SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
8981011892706AA257178SWMFCA1464SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)


Date: 8:23:46 on Thu 23 Nov 117.