CBrugiaQ_3319


Sequence

>CBrugiaQ_3319 (4 EST) Length=556 GAAATATTTTTGTATGTTGATTCATTACCCTTAACACAGAAGCAGTGAAATTTCGTTCCACATAACATTCTAATGGAAAA ACATTTAGCTAGACAAAAAACTCTATAAATCTCCTTCGCGTTCAATCTTGAGCAACTCGATATCGAATTTCAAACTGGCA TCGGCCGGAATTTTCGGCGGAGAACCGGAACTGCCATATGCCAGATCAGGTGGGATTGCAAGACGACGTTGTTCGCCCTC GCACATGTTCAATAGTCCTTGGTCCCATCCCTTAATAACTTGTCCATCCCGAGCGTGAATATGAATGGCTTATTGCGAGA CCAACTATTGTCGAAGTCGGTACCGTCCTCTAACATCCCCACGTAGTGCACGTTCAGAGTATCTCCCTTTCTTGATCTTA TCTCGCAGTTGTCGACACGCTTCTTGACTCCTATTTGCAAACGGGCTAATTCCTTGTCGTCGCAACAAACCATGACCAAA ACTAGTACTAATAGGACAACACTGCACTTTAACATTTCATGAACTACAGTCTAATTAGATCACCTCAAACTTGGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST,


Cluster Information for CBrugiaQ_3319: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
320238945439R86412SWAMCA371SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5595361345357W51510AS4SLC941T3Brugia malayi L4 JHU93SL-BmL4
8001241737507AA161714MBAFCE8F05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10751792113656AA430860RRAMCA349SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 13:13:57 on Wed 22 Nov 117.