CBrugiaQ_334


Sequence

>CBrugiaQ_334 (2 EST) Length=631 GGACTTTGCAATGACCATGATTCTATGATTTTTATAAACAAACATTAGAGGCTTGATGAACTCACTAGTATCCGGACCTT GTTTTCCGTTCGAGTTTTTGCATGCTGAAATAATACGCTATGAAAAACAACGGGAGGTAGAGCGGACTGACAAACGAAAA ATCTGGATTGAACAAATGCGCAGCAATCCGCAAATGGAAATCTCATTATTAGATGAACAATTGAAATCCGTGAAACAACT CTTCACTCAGTGCCGTAATGCTGAGACACGACTGGAAGCTCTCGGTTACCGTGTTGGTTTCGTGCTTGTTGAAAAAATTG CTAAAGACTTACCGAGATTAATCACTGAATTGGAAAGGATGAAATTCCTTTGTAAAGAATTTTGGACTGCTGTATTTGGC AGACAGGTTGACAATTTGCGTACTAATCACCAGGGAATTTATGTTGTACAGGATAACAAATTTTTCATCCTAACAAGTTT TCCCGGAAAGGAAAACAATATGTGGAAGAATCTGCTATCTATTTAGCCTTTTCATGTTGGTATCCTAAGGGGTGCACTGT ACAACCTCGGTATCACATCTTTAATTACATCCTCCCTTGGAAAATTTTCAGCTGTTGAAATTCCCGTTTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_334: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
8713681855024AA231983SWMFCA1378SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10480802064727AA406761MBAFCZ4A10T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 15:24:38 on Thu 23 Nov 117.