CBrugiaQ_3358


Sequence

>CBrugiaQ_3358 (7 EST) Length=274 TGAGAACAAAAATATCATTCAGGTGAATAATAGATTTTAATGGAAGGCACAAAAAGTATTTGGGTGTTACTGGTTATCCT ATTGTTATTTGAATATGTGGAATCTTATGGTTGGGGATACCCAGGTGGATATTACGGTGGTTACAGGCCTTACGGTGGAT ACGGGCCTTACGGTGGATATAGACCCGGATGGGGTTATGGTGGTGGAATGTTTGGTCGAGGATTTGGTGGACTTGGCTCG CTGCTTGGCAAGAAAAAATAACTGATTTTTGGTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3358: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217690808512R47625AS3ISA096SLBrugia malayi infective L3 JHU93SL-BmL3
281198889955H21260AS3ISB179SLBrugia malayi infective L3 JHU93SL-BmL3
281243890000H21305AS3ISB239SLBrugia malayi infective L3 JHU93SL-BmL3
4445691167370N43068SW3ICA1115SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
4446271167428N43123SW3ICA960SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)
5061231270750N99335TNPIBM3005Brugia malayi infective L3 JHU93SL-BmL3
7061761592594AA072521SW3ICA1528SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 2:32:17 on Wed 22 Nov 117.