CBrugiaQ_3361


Sequence

>CBrugiaQ_3361 (2 EST) Length=276 CGGCACGAGATAAGTGTTGTTTGGCAAAGAGAAGTGCTTGCAGAAATATTTTCAATGGAAGAGAAATTCCAGGCTGCTGT AAGTATTGTCCAGAAACATGCCAAAAACTGGTCCAATGGTACCAACAAATGATGAAAAACTTATGTTTTATTCTCTGTAC AAGCAAGAAACAGAGGGTAAAAATAAGAATGCACAACCAAATTTCTTGCATTTCCTGCAGAAAGCAAAATGGGAGGCATG GAAAAAATTAGGTGAAATGTCATCAGATGAAGCAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3361: (2 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6378871488486AA023870SWAMCA1087SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
9245731926175AA283481SW3ICA2120SKBrugia malayi infective larva cDNA (SAW94WL-BmL3)


Date: 23:1:24 on Fri 24 Nov 117.