CBrugiaQ_3371


Sequence

>CBrugiaQ_3371 (3 EST) Length=250 CGTCCTCAAATTTCTCCTGTAAACATTCTGCTATCAGTAAACTGTTTATGTGTCAAATATGTTCGCGTGAACAGCAGCAA CACATCAACTCACATCAATTACGATTATTTCCTATTTTTTGTACCTTTCAGTGAGCTTTAACATTCATATCTGCTCAAGA ATTAAGAACGCGTAATTCTATCTGCTTGAGAATTGAGGACCGAGAAGCACTAATACTAGCAAATAACGGCCGAAATATTT AGACATAACG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig,


Cluster Information for CBrugiaQ_3371: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217713808535R47648AS3ISB028SLBrugia malayi infective L3 JHU93SL-BmL3
8809691870953AA241648MBL2SJ2H10T3Brugia malayi second stage larvae JHU96SL-BmL2
11887292289593AA542681MB4SLY2A05T3Brugia malayi L4 JHU93SL-BmL4


Date: 4:21:38 on Wed 22 Nov 117.