CBrugiaQ_3384


Sequence

>CBrugiaQ_3384 (7 EST) Length=348 GTGGAGGGAAGAGGGAGAGACACTTTTGTTTTATATATATATATATATCTATATGTGAGAGAGAGAGAGAGAAAAAAAAA ACATAAATAGGGGGGGGGGGGGGGGGGAGAGTGAGAGAGAGTTGTGGGTGCGGAGAGAGAACACACACACACACACACAG ACACACACACACACAGCCACGCACACAGAGAGAGAGGGGGGGAGAGAGAGAGAGAGAGCGCGNGCGAGCGNGTGTGTGAT GTGTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCCGCGCGGCGAGCGCGAAAAGAGA GAATTTCCCCCNCCAGAGNAGACACTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3384: (7 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4809691236206N74807RRAMCA1078SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5220981289170W15126RRAMCA1259SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
5801011382102W59888SWAMCA766SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
7620071681875AA123564MBAFCE7H08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8679201850685AA228585SWMFCA1280SKBrugia malayi microfilaria cDNA (SAW94LS-BmMF)
10480992064746AA406780MBAFCZ4C08T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
13814682655588AA675882MBAFCW5H07T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)


Date: 19:32:53 on Sun 19 Nov 117.