CBrugiaQ_3385


Sequence

>CBrugiaQ_3385 (10 EST) Length=667 CGAAAACTTATATATTTTCCACTTGTGTACAAAACATTCTAAAATGATCAGAAAATCAGTTTTTCTGGGAAGAAATTTTA TACGAACAATAACCATAATGGAAGATTCAAAAGTCATCTCTTCGATCATTAAATTAAAGAAATAATCCAAAAACTGAAAA CTCAAAATTAAAAATAAAACATTATATAATCATGTCAATAACAGTAAAGTCCAGAAAAAATATGTANNATGTNGCCTAGT CACTGNTCCATATGATANCATCGCAGANACCGAAACCACGCGGACGGCCTGTGTCCCGATCCAACACGATGCGCACGCTG GTTACCGGACCGACTTGCCAAAAGAAATTTGCCACATCCTCCTCTCTTGCACTGTAAGGCAAGTTTCCAACAAATACTGA GCGAGACATGATCTCCGGAACCGTACGTAAGACCTCGACAAGAGACAGAAGCGACCCGAGAACTCAAACTTGGGTAATTA AACCCGGAATTCCTCATAAAGGAATGGCTCAGAAACGAGCTTCTCAGCTACTTCGTTCATTGAAACCGGTAGCATCACGC CGTGGACGACGTGTGCGCAAGACAGAAGTCTGATTAAGTTTTATATGGTTATTGTTTTATCTACCTTTCACATAATTTGA TTGCATAAAATGTTTTCTAAACNNAAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr, dbEST, Processing,


Cluster Information for CBrugiaQ_3385: (10 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576301193267N52101KJ4SLB116T3JHU93SL-BmL4 (JHU)
5362471309127W29143RRAMCA1348SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8809421870926AA241660MBL2SJ2E2T3Brugia malayi second stage larvae JHU96SL-BmL2
8809521870936AA241566MBL2SJ2F5T3Brugia malayi second stage larvae JHU96SL-BmL2
8810741871058AA241532MBL2SJ9C3T3Brugia malayi second stage larvae JHU96SL-BmL2
8811281871112AA241508MBL2SJ9H3T3Brugia malayi second stage larvae JHU96SL-BmL2
8987141893319AA257738MBL2SJ3G3T3Brugia malayi second stage larvae JHU96SL-BmL2
9165441917164AA275516MBL2SK1G12T3Brugia malayi second stage larvae JHU96SL-BmL2
9165491917169AA275521MBL2SK1H05T3Brugia malayi second stage larvae JHU96SL-BmL2
13736282629543AA668044MBL2SJ0E1AT3Brugia malayi second stage larvae JHU96SL-BmL2


Date: 8:45:25 on Fri 24 Nov 117.