CBrugiaQ_3393


Sequence

>CBrugiaQ_3393 (4 EST) Length=262 CAGCTTCTTCGAGGCGCTTACGCACTTCCGCTTTTTTCATTTCTCTCTCCTCCGCTTTACGTTTGGCCTCGGAATCATCC TCTTCGCCGAGAGGACCTCCATATCGTGGACGATCGTCACACTCAGGCACTTCGTTGCTCTTATATTCATTTATATCCAT ATTGCAATTTGTAAGTAATTCTTTCAGGTTGAATAGGGAAGCTAATCCGTGAAGGATTATTATTTTTAAGAAGTAAAACG GATTGTGCTNTGTCGAAAAGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, dbEST,


Cluster Information for CBrugiaQ_3393: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
217681808503R47616AS3ISA051SLBrugia malayi infective L3 JHU93SL-BmL3
276428881994H16490AS3ISB287SLBrugia malayi infective L3 JHU93SL-BmL3
276436882002H16498AS3ISB315SLBrugia malayi infective L3 JHU93SL-BmL3
8712881854360AA231946AS3ISB102T3Brugia malayi infective L3 JHU93SL-BmL3


Date: 19:22:22 on Wed 22 Nov 117.