CBrugiaQ_3395


Sequence

>CBrugiaQ_3395 (3 EST) Length=325 ATATATCTTTTTGCCAAGTATCAAGCTAATAATCGGGCTAACTAAGTGCGGGAATTGAGATAGATCCTACGCTCTCTGAG AACATTGAACATCGCTCTAAACTAGCTCTGTCTNGCTATTCTCAGGATCCATGTTCGTCTTTCTAAGAGNAAACCCAGCA ACTTCACGAATCAGTTCACGAACAATTTTACTCCTTCTTGGTTATACGTCCTTACGTCTACTTTGACGCATTTTCCTTTG ATTTTTCGTTACCTTGTAACCAGCATTAAGACCCACAGCAACTGCTNTCAACTGCACCATTTCTTTTCCTCAAACTTGGG TAATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, Processing,


Cluster Information for CBrugiaQ_3395: (3 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
4576261193263N52097KJ4SLB090T3JHU93SL-BmL4 (JHU)
4958751442866N89536KJ4SLB223T3JHU93SL-BmL4 (JHU)
8678941850659AA228553KJ4SLB405T3JHU93SL-BmL4 (JHU)


Date: 14:24:35 on Mon 20 Nov 117.