CBrugiaQ_340


Sequence

>CBrugiaQ_340 (4 EST) Length=766 TTTGAGGAAACAAATATCAGCGAAAAATGTTTTCACATATTGTTGCAACTATGTCTATCATTTTTATAACACTCGCATTT GCTGCAAATCAAGTTTGTGAAGATATGTACAATCAGTGCGAAAGCACAATTTGCACTGATCCAATGGCAAAAGAAATTTG CGCTAAAACTTGCGGATTTTGTGAAATGACAACTTCTACGGCTGTAACACCTGTTTGTGATGACGCATACAATCAATGTG ACAGTACAATTTGCACTATGCCAATAGCTAGTGAAATTTGCGCCAAAACATGTGGATTTTGCGGAGTAGCGCCTTCTACA GCAGTAACACCTGTTTGTGATGACTTATTCGATCAATGCGATCATACAGTTTGCACAATTCCAATGTCAAAAGAAATTTG CGCCAGAACATGTGGTTTTTGCGGAACAACACCTCTTGTGACAGTAACACCTGTCTGTGAGGACAAATATAGTAAATGCA AAAGTAATATGAACTGTACAAATGCATTAGCTAAAGAACTATGCGCTAAAACATGCGGATTTTGTGATAATGATTCGATG CCAACACCAGAAGAATGTTCACATTTATGTCAACCATTGCAATCACTATGCACATTTGTCGGATGGATTATGGGACCAGT TACGCATGGATTTTGTCTACGTTGTCAACAATGCAAATAAAACAATATTAAATTGAATAATTTTAGAACAATTTAATCGC TGGAATAATTTGTATTTTTGATAAAATTAATAAACTTTTCATGTTG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Contig, gbnr,


Cluster Information for CBrugiaQ_340: (4 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
6807401547303AA054896RRAMCA290SKBrugia malayi adult male cDNA (SAW94NL-BmAM)
8001881737571AA161561MBAFCF1B05T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
8985991893204AA257442MBAFCZ3C11T3Brugia malayi adult female cDNA (SAW96MLW-BmAF)
10777082130891AA433414SWAMCA1889SKBrugia malayi adult male cDNA (SAW94NL-BmAM)


Date: 16:22:46 on Sat 18 Nov 117.